DNA derived data

http://rs.gbif.org/terms/1.0/DNADerivedData

An extension to Occurrence and Event cores to capture information relating to DNA. This extension is based on the MIxS extension for Darwin Core (underway), with additions from GGBN and MIQE standards and recommendations. This definition supports the outcomes documented in Publishing DNA-derived data through biodiversity data platforms (https://doi.org/10.35035/doc-vf1a-nr22). This extension is subject to change, and recommended for early adopters who understand that data remapping may be required as things evolve.

Link: https://w3id.org/gensc/


Properties



samp_name
Sample Name is a name that you choose for the sample. It can have any format, but we suggest that you make it concise, unique and consistent within your lab, and as informative as possible. Every Sample Name from a single Submitter must be unique.
Examples:
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0001107
Namespacehttps://w3id.org/gensc/terms/
Group
Data Type string
Requiredfalse

investigation

project_name
Name of the project within which the sequencing was organized
Examples: Forest soil metagenome
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000092
Namespacehttps://w3id.org/gensc/terms/
Groupinvestigation
Data Type string
Requiredfalse
experimental_factor
Experimental factors are essentially the variable aspects of an experiment design which can be used to describe an experiment, or set of experiments, in an increasingly detailed manner. This field accepts ontology terms from Experimental Factor Ontology (EFO) and/or Ontology for Biomedical Investigations (OBI). For a browser of EFO (v 2.95) terms, please see http://purl.bioontology.org/ontology/EFO; for a browser of OBI (v 2018-02-12) terms please see http://purl.bioontology.org/ontology/OBI
Examples: time series design [EFO:EFO_0001779]
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000008
Namespacehttps://w3id.org/gensc/terms/
Groupinvestigation
Data Type string
Requiredfalse

environment

env_broad_scale
In this field, report which major environmental system your sample or specimen came from. The systems identified should have a coarse spatial grain, to provide the general environmental context of where the sampling was done (e.g. were you in the desert or a rainforest?). We recommend using subclasses of ENVO’s biome class: http://purl.obolibrary.org/obo/ENVO_00000428. Format (one term): termLabel [termID], Format (multiple terms): termLabel [termID]|termLabel [termID]|termLabel [termID]. Example: Annotating a water sample from the photic zone in middle of the Atlantic Ocean, consider: oceanic epipelagic zone biome [ENVO:01000033]. Example: Annotating a sample from the Amazon rainforest consider: tropical moist broadleaf forest biome [ENVO:01000228]. If needed, request new terms on the ENVO tracker, identified here: http://www.obofoundry.org/ontology/envo.html
Examples: forest biome [ENVO:01000174]
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000012
Namespacehttps://w3id.org/gensc/terms/
Groupenvironment
Data Type string
Requiredfalse
env_local_scale
In this field, report the entity or entities which are in your sample or specimen’s local vicinity and which you believe have significant causal influences on your sample or specimen. Please use terms that are present in ENVO and which are of smaller spatial grain than your entry for env_broad_scale. Format (one term): termLabel [termID]; Format (multiple terms): termLabel [termID]|termLabel [termID]|termLabel [termID]. Example: Annotating a pooled sample taken from various vegetation layers in a forest consider: canopy [ENVO:00000047]|herb and fern layer [ENVO:01000337]|litter layer [ENVO:01000338]|understory [01000335]|shrub layer [ENVO:01000336]. If needed, request new terms on the ENVO tracker, identified here: http://www.obofoundry.org/ontology/envo.html
Examples: litter layer [ENVO:01000338]
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000013
Namespacehttps://w3id.org/gensc/terms/
Groupenvironment
Data Type string
Requiredfalse
env_medium
In this field, report which environmental material or materials (pipe separated) immediately surrounded your sample or specimen prior to sampling, using one or more subclasses of ENVO’s environmental material class: http://purl.obolibrary.org/obo/ENVO_00010483. Format (one term): termLabel [termID]; Format (multiple terms): termLabel [termID]|termLabel [termID]|termLabel [termID]. Example: Annotating a fish swimming in the upper 100 m of the Atlantic Ocean, consider: ocean water [ENVO:00002151]. Example: Annotating a duck on a pond consider: pond water [ENVO:00002228]|air ENVO_00002005. If needed, request new terms on the ENVO tracker, identified here: http://www.obofoundry.org/ontology/envo.html
Examples: soil [ENVO:00001998]
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000014
Namespacehttps://w3id.org/gensc/terms/
Groupenvironment
Data Type string
Requiredfalse

nucleic acid sequence source

subspecf_gen_lin
This should provide further information about the genetic distinctness of the sequenced organism by recording additional information e.g. serovar, serotype, biotype, ecotype, or any relevant genetic typing schemes like Group I plasmid. It can also contain alternative taxonomic information. It should contain both the lineage name, and the lineage rank, i.e. biovar:abc123
Examples: serovar:Newport
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000020
Namespacehttps://w3id.org/gensc/terms/
Groupnucleic acid sequence source
Data Type string
Requiredfalse
ploidy
The ploidy level of the genome (e.g. allopolyploid, haploid, diploid, triploid, tetraploid). It has implications for the downstream study of duplicated gene and regions of the genomes (and perhaps for difficulties in assembly). For terms, please select terms listed under class ploidy (PATO:001374) of Phenotypic Quality Ontology (PATO), and for a browser of PATO (v 2018-03-27) please refer to http://purl.bioontology.org/ontology/PATO
Examples: allopolyploidy [PATO:0001379]
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000021
Namespacehttps://w3id.org/gensc/terms/
Groupnucleic acid sequence source
Data Type string
Requiredfalse
num_replicons
Reports the number of replicons in a nuclear genome of eukaryotes, in the genome of a bacterium or archaea or the number of segments in a segmented virus. Always applied to the haploid chromosome count of a eukaryote
Examples: 2
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000022
Namespacehttps://w3id.org/gensc/terms/
Groupnucleic acid sequence source
Data Type integer
Requiredfalse
extrachrom_elements
Do plasmids exist of significant phenotypic consequence (e.g. ones that determine virulence or antibiotic resistance). Megaplasmids? Other plasmids (borrelia has 15+ plasmids)
Examples: 5
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000023
Namespacehttps://w3id.org/gensc/terms/
Groupnucleic acid sequence source
Data Type integer
Requiredfalse
estimated_size
The estimated size of the genome prior to sequencing. Of particular importance in the sequencing of (eukaryotic) genome which could remain in draft form for a long or unspecified period.
Examples: 300000 bp
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000024
Namespacehttps://w3id.org/gensc/terms/
Groupnucleic acid sequence source
Data Type string
Requiredfalse
ref_biomaterial
Primary publication if isolated before genome publication; otherwise, primary genome report
Examples: doi:10.1016/j.syapm.2018.01.009
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000025
Namespacehttps://w3id.org/gensc/terms/
Groupnucleic acid sequence source
Data Type uri
Requiredfalse
source_mat_id
A unique identifier assigned to a material sample (as defined by http://rs.tdwg.org/dwc/terms/materialSampleID, and as opposed to a particular digital record of a material sample) used for extracting nucleic acids, and subsequent sequencing. The identifier can refer either to the original material collected or to any derived sub-samples. The INSDC qualifiers /specimen_voucher, /bio_material, or /culture_collection may or may not share the same value as the source_mat_id field. For instance, the /specimen_voucher qualifier and source_mat_id may both contain ´UAM:Herps:14´ , referring to both the specimen voucher and sampled tissue with the same identifier. However, the /culture_collection qualifier may refer to a value from an initial culture (e.g. ATCC:11775) while source_mat_id would refer to an identifier from some derived culture from which the nucleic acids were extracted (e.g. xatc123 or ark:/2154/R2).
Examples: MPI012345
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000026
Namespacehttps://w3id.org/gensc/terms/
Groupnucleic acid sequence source
Data Type string
Requiredfalse
pathogenicity
To what is the entity pathogenic
Examples: human, animal, plant, fungi, bacteria
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000027
Namespacehttps://w3id.org/gensc/terms/
Groupnucleic acid sequence source
Data Type string
Requiredfalse
biotic_relationship
Description of relationship(s) between the subject organism and other organism(s) it is associated with. E.g., parasite on species X; mutualist with species Y. The target organism is the subject of the relationship, and the other organism(s) is the object
Examples: free living
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000028
Namespacehttps://w3id.org/gensc/terms/
Groupnucleic acid sequence source
Data Type Genomic Standards Consortium biotic_relationship Vocabulary (MIXS:0000028)
Requiredfalse
specific_host
If there is a host involved, please provide its taxid (or environmental if not actually isolated from the dead or alive host - i.e. a pathogen could be isolated from a swipe of a bench etc) and report whether it is a laboratory or natural host)
Examples: 9606
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000029
Namespacehttps://w3id.org/gensc/terms/
Groupnucleic acid sequence source
Data Type string
Requiredfalse
host_spec_range
The NCBI taxonomy identifier of the specific host if it is known
Examples: 9606
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000030
Namespacehttps://w3id.org/gensc/terms/
Groupnucleic acid sequence source
Data Type integer
Requiredfalse
host_disease_stat
List of diseases with which the host has been diagnosed; can include multiple diagnoses. The value of the field depends on host; for humans the terms should be chosen from the DO (Human Disease Ontology) at https://www.disease-ontology.org, non-human host diseases are free text
Examples: dead
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000031
Namespacehttps://w3id.org/gensc/terms/
Groupnucleic acid sequence source
Data Type string
Requiredfalse
trophic_level
Trophic levels are the feeding position in a food chain. Microbes can be a range of producers (e.g. chemolithotroph)
Examples: heterotroph
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000032
Namespacehttps://w3id.org/gensc/terms/
Groupnucleic acid sequence source
Data Type Genomic Standards Consortium trophic_level Vocabulary (MIXS:0000032)
Requiredfalse
propagation
This field is specific to different taxa. For phages: lytic/lysogenic, for plasmids: incompatibility group, for eukaryotes: sexual/asexual (Note: there is the strong opinion to name phage propagation obligately lytic or temperate, therefore we also give this choice
Examples: lytic
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000033
Namespacehttps://w3id.org/gensc/terms/
Groupnucleic acid sequence source
Data Type string
Requiredfalse
encoded_traits
Should include key traits like antibiotic resistance or xenobiotic degradation phenotypes for plasmids, converting genes for phage
Examples: beta-lactamase class A
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000034
Namespacehttps://w3id.org/gensc/terms/
Groupnucleic acid sequence source
Data Type string
Requiredfalse
rel_to_oxygen
Is this organism an aerobe, anaerobe? Please note that aerobic and anaerobic are valid descriptors for microbial environments
Examples: aerobe
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000015
Namespacehttps://w3id.org/gensc/terms/
Groupnucleic acid sequence source
Data Type Genomic Standards Consortium rel_to_oxygen Vocabulary (MIXS:0000015)
Requiredfalse
isol_growth_condt
Publication reference in the form of pubmed ID (pmid), digital object identifier (doi) or url for isolation and growth condition specifications of the organism/material
Examples: doi: 10.1016/j.syapm.2018.01.009
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000003
Namespacehttps://w3id.org/gensc/terms/
Groupnucleic acid sequence source
Data Type uri
Requiredfalse
samp_collec_device
The device used to collect an environmental sample. This field accepts terms listed under environmental sampling device (http://purl.obolibrary.org/obo/ENVO). This field also accepts terms listed under specimen collection device (http://purl.obolibrary.org/obo/GENEPIO_0002094).
Examples: environmental swab sampling, biopsy, niskin bottle, push core
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000002
Namespacehttps://w3id.org/gensc/terms/
Groupnucleic acid sequence source
Data Type string
Requiredfalse
samp_collec_method
The method employed for collecting the sample
Examples: environmental swab sampling, biopsy, niskin bottle, push core
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0001225
Namespacehttps://w3id.org/gensc/terms/
Groupnucleic acid sequence source
Data Type string
Requiredfalse
samp_mat_process
Any processing applied to the sample during or after retrieving the sample from environment. This field accepts OBI, for a browser of OBI (v 2018-02-12) terms please see http://purl.bioontology.org/ontology/OBI
Examples: filtering of seawater, storing samples in ethanol
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000016
Namespacehttps://w3id.org/gensc/terms/
Groupnucleic acid sequence source
Data Type string
Requiredfalse
size_frac
Filtering pore size used in sample preparation
Examples: 0-0.22 micrometer
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000017
Namespacehttps://w3id.org/gensc/terms/
Groupnucleic acid sequence source
Data Type string
Requiredfalse
samp_size
Amount or size of sample (volume, mass or area) that was collected
Examples: 5 liter
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000001
Namespacehttps://w3id.org/gensc/terms/
Groupnucleic acid sequence source
Data Type string
Requiredfalse
samp_vol_we_dna_ext
Volume (ml) or mass (g) of total collected sample processed for DNA extraction. Note: total sample collected should be entered under the term Sample Size (MIXS:0000001).
Examples: 1500 milliliter
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000111
Namespacehttps://w3id.org/gensc/terms/
Groupnucleic acid sequence source
Data Type string
Requiredfalse
source_uvig
Type of dataset from which the UViG was obtained
Examples: viral fraction metagenome (virome)
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000035
Namespacehttps://w3id.org/gensc/terms/
Groupnucleic acid sequence source
Data Type Genomic Standards Consortium source_uvig Vocabulary (MIXS:0000035)
Requiredfalse
virus_enrich_appr
List of approaches used to enrich the sample for viruses, if any
Examples: filtration + FeCl Precipitation + ultracentrifugation + DNAse
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000036
Namespacehttps://w3id.org/gensc/terms/
Groupnucleic acid sequence source
Data Type Genomic Standards Consortium virus_enrich_appr Vocabulary (MIXS:0000036)
Requiredfalse

sequencing

nucl_acid_ext
A link to a literature reference, electronic resource or a standard operating procedure (SOP), that describes the material separation to recover the nucleic acid fraction from a sample
Examples: https://mobio.com/media/wysiwyg/pdfs/protocols/12888.pdf
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000037
Namespacehttps://w3id.org/gensc/terms/
Groupsequencing
Data Type uri
Requiredfalse
nucl_acid_amp
A link to a literature reference, electronic resource or a standard operating procedure (SOP), that describes the enzymatic amplification (PCR, TMA, NASBA) of specific nucleic acids
Examples: https://phylogenomics.me/protocols/16s-pcr-protocol/
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000038
Namespacehttps://w3id.org/gensc/terms/
Groupsequencing
Data Type uri
Requiredfalse
lib_size
Total number of clones in the library prepared for the project
Examples: 50
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000039
Namespacehttps://w3id.org/gensc/terms/
Groupsequencing
Data Type integer
Requiredfalse
lib_reads_seqd
Total number of clones sequenced from the library
Examples: 20
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000040
Namespacehttps://w3id.org/gensc/terms/
Groupsequencing
Data Type integer
Requiredfalse
lib_layout
Specify whether to expect single, paired, or other configuration of reads
Examples: paired
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000041
Namespacehttps://w3id.org/gensc/terms/
Groupsequencing
Data Type Genomic Standards Consortium lib_layout Vocabulary (MIXS:0000041)
Requiredfalse
lib_vector
Cloning vector type(s) used in construction of libraries
Examples: Bacteriophage P1
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000042
Namespacehttps://w3id.org/gensc/terms/
Groupsequencing
Data Type string
Requiredfalse
lib_screen
Specific enrichment or screening methods applied before and/or after creating libraries
Examples: enriched, screened, normalized
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000043
Namespacehttps://w3id.org/gensc/terms/
Groupsequencing
Data Type string
Requiredfalse
target_gene
Targeted gene or locus name for marker gene studies
Examples: 16S rRNA, 18S rRNA, nif, amoA, rpo
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000044
Namespacehttps://w3id.org/gensc/terms/
Groupsequencing
Data Type string
Requiredfalse
target_subfragment
Name of subfragment of a gene or locus. Important to e.g. identify special regions on marker genes like V6 on 16S rRNA
Examples: V6, V9, ITS
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000045
Namespacehttps://w3id.org/gensc/terms/
Groupsequencing
Data Type string
Requiredfalse
pcr_primers
PCR primers that were used to amplify the sequence of the targeted gene, locus or subfragment. This field should contain all the primers used for a single PCR reaction if multiple forward or reverse primers are present in a single PCR reaction. The primer sequence should be reported in uppercase letters
Examples: FWD:GTGCCAGCMGCCGCGGTAA;REV:GGACTACHVGGGTWTCTAAT
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000046
Namespacehttps://w3id.org/gensc/terms/
Groupsequencing
Data Type string
Requiredfalse
mid
Molecular barcodes, called Multiplex Identifiers (MIDs), that are used to specifically tag unique samples in a sequencing run. Sequence should be reported in uppercase letters
Examples: GTGAATAT
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000047
Namespacehttps://w3id.org/gensc/terms/
Groupsequencing
Data Type string
Requiredfalse
adapters
Adapters provide priming sequences for both amplification and sequencing of the sample-library fragments. Both adapters should be reported; in uppercase letters
Examples: AATGATACGGCGACCACCGAGATCTACACGCT;CAAGCAGAAGACGGCATACGAGAT
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000048
Namespacehttps://w3id.org/gensc/terms/
Groupsequencing
Data Type string
Requiredfalse
pcr_cond
Description of reaction conditions and components of PCR in the form of ´initial denaturation:94degC_1.5min; annealing=...´
Examples: initial denaturation:94_3;annealing:50_1;elongation:72_1.5;final elongation:72_10;35
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000049
Namespacehttps://w3id.org/gensc/terms/
Groupsequencing
Data Type string
Requiredfalse
seq_meth
Sequencing method used; e.g. Sanger, ABI-solid
Examples: Illumina HiSeq 1500
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000050
Namespacehttps://w3id.org/gensc/terms/
Groupsequencing
Data Type Genomic Standards Consortium seq_meth Vocabulary (MIXS:0000050)
Requiredfalse
seq_quality_check
Indicate if the sequence has been called by automatic systems (none) or undergone a manual editing procedure (e.g. by inspecting the raw data or chromatograms). Applied only for sequences that are not submitted to SRA,ENA or DRA
Examples: none
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000051
Namespacehttps://w3id.org/gensc/terms/
Groupsequencing
Data Type string
Requiredfalse
chimera_check
A chimeric sequence, or chimera for short, is a sequence comprised of two or more phylogenetically distinct parent sequences. Chimeras are usually PCR artifacts thought to occur when a prematurely terminated amplicon reanneals to a foreign DNA strand and is copied to completion in the following PCR cycles. The point at which the chimeric sequence changes from one parent to the next is called the breakpoint or conversion point
Examples: uchime;v4.1;default parameters
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000052
Namespacehttps://w3id.org/gensc/terms/
Groupsequencing
Data Type string
Requiredfalse
tax_ident
The phylogenetic marker(s) used to assign an organism name to the SAG or MAG
Examples: other: rpoB gene
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000053
Namespacehttps://w3id.org/gensc/terms/
Groupsequencing
Data Type Genomic Standards Consortium tax_ident Vocabulary (MIXS:0000053)
Requiredfalse
assembly_qual
The assembly quality category is based on sets of criteria outlined for each assembly quality category. For MISAG/MIMAG; Finished: Single, validated, contiguous sequence per replicon without gaps or ambiguities with a consensus error rate equivalent to Q50 or better. High Quality Draft:Multiple fragments where gaps span repetitive regions. Presence of the 23S, 16S and 5S rRNA genes and at least 18 tRNAs. Medium Quality Draft:Many fragments with little to no review of assembly other than reporting of standard assembly statistics. Low Quality Draft:Many fragments with little to no review of assembly other than reporting of standard assembly statistics. Assembly statistics include, but are not limited to total assembly size, number of contigs, contig N50/L50, and maximum contig length. For MIUVIG; Finished: Single, validated, contiguous sequence per replicon without gaps or ambiguities, with extensive manual review and editing to annotate putative gene functions and transcriptional units. High-quality draft genome: One or multiple fragments, totaling ≥ 90% of the expected genome or replicon sequence or predicted complete. Genome fragment(s): One or multiple fragments, totalling < 90% of the expected genome or replicon sequence, or for which no genome size could be estimated
Examples: High-quality draft genome
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000056
Namespacehttps://w3id.org/gensc/terms/
Groupsequencing
Data Type Genomic Standards Consortium assembly_qual Vocabulary (MIXS:0000056)
Requiredfalse
assembly_name
Name/version of the assembly provided by the submitter that is used in the genome browsers and in the community
Examples: HuRef, JCVI_ISG_i3_1.0
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000057
Namespacehttps://w3id.org/gensc/terms/
Groupsequencing
Data Type string
Requiredfalse
assembly_software
Tool(s) used for assembly, including version number and parameters
Examples: metaSPAdes;3.11.0;kmer set 21,33,55,77,99,121, default parameters otherwise
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000058
Namespacehttps://w3id.org/gensc/terms/
Groupsequencing
Data Type string
Requiredfalse
annot
Tool used for annotation, or for cases where annotation was provided by a community jamboree or model organism database rather than by a specific submitter
Examples: prokka
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000059
Namespacehttps://w3id.org/gensc/terms/
Groupsequencing
Data Type string
Requiredfalse
number_contig
Total number of contigs in the cleaned/submitted assembly that makes up a given genome, SAG, MAG, or UViG
Examples: 40
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000060
Namespacehttps://w3id.org/gensc/terms/
Groupsequencing
Data Type integer
Requiredfalse
feat_pred
Method used to predict UViGs features such as ORFs, integration site, etc.
Examples: Prodigal;2.6.3;default parameters
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000061
Namespacehttps://w3id.org/gensc/terms/
Groupsequencing
Data Type string
Requiredfalse
ref_db
List of database(s) used for ORF annotation, along with version number and reference to website or publication
Examples: pVOGs;5;http://dmk-brain.ecn.uiowa.edu/pVOGs/ Grazziotin et al. 2017 doi:10.1093/nar/gkw975
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000062
Namespacehttps://w3id.org/gensc/terms/
Groupsequencing
Data Type string
Requiredfalse
sim_search_meth
Tool used to compare ORFs with database, along with version and cutoffs used
Examples: HMMER3;3.1b2;hmmsearch, cutoff of 50 on score
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000063
Namespacehttps://w3id.org/gensc/terms/
Groupsequencing
Data Type string
Requiredfalse
tax_class
Method used for taxonomic classification, along with reference database used, classification rank, and thresholds used to classify new genomes
Examples: vConTACT vContact2 (references from NCBI RefSeq v83, genus rank classification, default parameters)
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000064
Namespacehttps://w3id.org/gensc/terms/
Groupsequencing
Data Type string
Requiredfalse
_16s_recover
Can a 16S gene be recovered from the submitted SAG or MAG?
Examples: yes
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000065
Namespacehttps://w3id.org/gensc/terms/
Groupsequencing
Data Type boolean
Requiredfalse
_16s_recover_software
Tools used for 16S rRNA gene extraction
Examples: rambl;v2;default parameters
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000066
Namespacehttps://w3id.org/gensc/terms/
Groupsequencing
Data Type string
Requiredfalse
trnas
The total number of tRNAs identified from the SAG or MAG
Examples: 18
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000067
Namespacehttps://w3id.org/gensc/terms/
Groupsequencing
Data Type integer
Requiredfalse
trna_ext_software
Tools used for tRNA identification
Examples: infernal;v2;default parameters
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000068
Namespacehttps://w3id.org/gensc/terms/
Groupsequencing
Data Type string
Requiredfalse
compl_score
Completeness score is typically based on either the fraction of markers found as compared to a database or the percent of a genome found as compared to a closely related reference genome. High Quality Draft: >90%, Medium Quality Draft: >50%, and Low Quality Draft: < 50% should have the indicated completeness scores
Examples: med;60%
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000069
Namespacehttps://w3id.org/gensc/terms/
Groupsequencing
Data Type string
Requiredfalse
compl_software
Tools used for completion estimate, i.e. checkm, anvi´o, busco
Examples: checkm
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000070
Namespacehttps://w3id.org/gensc/terms/
Groupsequencing
Data Type string
Requiredfalse
compl_appr
The approach used to determine the completeness of a given SAG or MAG, which would typically make use of a set of conserved marker genes or a closely related reference genome. For UViG completeness, include reference genome or group used, and contig feature suggesting a complete genome
Examples: other: UViG length compared to the average length of reference genomes from the P22virus genus (NCBI RefSeq v83)
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000071
Namespacehttps://w3id.org/gensc/terms/
Groupsequencing
Data Type Genomic Standards Consortium compl_appr Vocabulary (MIXS:0000071)
Requiredfalse
contam_score
The contamination score is based on the fraction of single-copy genes that are observed more than once in a query genome. The following scores are acceptable for; High Quality Draft: < 5%, Medium Quality Draft: < 10%, Low Quality Draft: < 10%. Contamination must be below 5% for a SAG or MAG to be deposited into any of the public databases
Examples: 1%
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000072
Namespacehttps://w3id.org/gensc/terms/
Groupsequencing
Data Type string
Requiredfalse
contam_screen_input
The type of sequence data used as input
Examples: contigs
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000005
Namespacehttps://w3id.org/gensc/terms/
Groupsequencing
Data Type Genomic Standards Consortium contam_screen_input Vocabulary (MIXS:0000005)
Requiredfalse
contam_screen_param
Specific parameters used in the decontamination sofware, such as reference database, coverage, and kmers. Combinations of these parameters may also be used, i.e. kmer and coverage, or reference database and kmer
Examples: kmer
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000073
Namespacehttps://w3id.org/gensc/terms/
Groupsequencing
Data Type string
Requiredfalse
decontam_software
Tool(s) used in contamination screening
Examples: anvi´o
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000074
Namespacehttps://w3id.org/gensc/terms/
Groupsequencing
Data Type Genomic Standards Consortium decontam_software Vocabulary (MIXS:0000074)
Requiredfalse
sort_tech
Method used to sort/isolate cells or particles of interest
Examples: optical manipulation
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000075
Namespacehttps://w3id.org/gensc/terms/
Groupsequencing
Data Type Genomic Standards Consortium sort_tech Vocabulary (MIXS:0000075)
Requiredfalse
single_cell_lysis_appr
Method used to free DNA from interior of the cell(s) or particle(s)
Examples: enzymatic
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000076
Namespacehttps://w3id.org/gensc/terms/
Groupsequencing
Data Type Genomic Standards Consortium single_cell_lysis_appr Vocabulary (MIXS:0000076)
Requiredfalse
single_cell_lysis_prot
Name of the kit or standard protocol used for cell(s) or particle(s) lysis
Examples: ambion single cell lysis kit
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000054
Namespacehttps://w3id.org/gensc/terms/
Groupsequencing
Data Type string
Requiredfalse
wga_amp_appr
Method used to amplify genomic DNA in preparation for sequencing
Examples: mda based
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000055
Namespacehttps://w3id.org/gensc/terms/
Groupsequencing
Data Type Genomic Standards Consortium wga_amp_appr Vocabulary (MIXS:0000055)
Requiredfalse
wga_amp_kit
Kit used to amplify genomic DNA in preparation for sequencing
Examples: qiagen repli-g
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000006
Namespacehttps://w3id.org/gensc/terms/
Groupsequencing
Data Type string
Requiredfalse
bin_param
The parameters that have been applied during the extraction of genomes from metagenomic datasets
Examples: coverage and kmer
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000077
Namespacehttps://w3id.org/gensc/terms/
Groupsequencing
Data Type Genomic Standards Consortium bin_param Vocabulary (MIXS:0000077)
Requiredfalse
bin_software
Tool(s) used for the extraction of genomes from metagenomic datasets
Examples: concoct and maxbin
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000078
Namespacehttps://w3id.org/gensc/terms/
Groupsequencing
Data Type Genomic Standards Consortium bin_software Vocabulary (MIXS:0000078)
Requiredfalse
reassembly_bin
Has an assembly been performed on a genome bin extracted from a metagenomic assembly?
Examples: no
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000079
Namespacehttps://w3id.org/gensc/terms/
Groupsequencing
Data Type boolean
Requiredfalse
mag_cov_software
Tool(s) used to determine the genome coverage if coverage is used as a binning parameter in the extraction of genomes from metagenomic datasets
Examples: bbmap
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000080
Namespacehttps://w3id.org/gensc/terms/
Groupsequencing
Data Type Genomic Standards Consortium mag_cov_software Vocabulary (MIXS:0000080)
Requiredfalse
vir_ident_software
Tool(s) used for the identification of UViG as a viral genome, software or protocol name including version number, parameters, and cutoffs used
Examples: VirSorter; 1.0.4; Virome database, category 2
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000081
Namespacehttps://w3id.org/gensc/terms/
Groupsequencing
Data Type string
Requiredfalse
pred_genome_type
Type of genome predicted for the UViG
Examples: dsDNA
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000082
Namespacehttps://w3id.org/gensc/terms/
Groupsequencing
Data Type Genomic Standards Consortium pred_genome_type Vocabulary (MIXS:0000082)
Requiredfalse
pred_genome_struc
Expected structure of the viral genome
Examples: non-segmented
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000083
Namespacehttps://w3id.org/gensc/terms/
Groupsequencing
Data Type Genomic Standards Consortium pred_genome_struc Vocabulary (MIXS:0000083)
Requiredfalse
detec_type
Type of UViG detection
Examples: independent sequence (UViG)
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000084
Namespacehttps://w3id.org/gensc/terms/
Groupsequencing
Data Type Genomic Standards Consortium detec_type Vocabulary (MIXS:0000084)
Requiredfalse
otu_class_appr
Cutoffs and approach used when clustering new UViGs in "species-level" OTUs. Note that results from standard 95% ANI / 85% AF clustering should be provided alongside OTUS defined from another set of thresholds, even if the latter are the ones primarily used during the analysis
Examples: 95% ANI;85% AF; greedy incremental clustering
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000085
Namespacehttps://w3id.org/gensc/terms/
Groupsequencing
Data Type string
Requiredfalse
otu_seq_comp_appr
Tool and thresholds used to compare sequences when computing "species-level" OTUs
Examples: blastn;2.6.0+;e-value cutoff: 0.001
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000086
Namespacehttps://w3id.org/gensc/terms/
Groupsequencing
Data Type string
Requiredfalse
otu_db
Reference database (i.e. sequences not generated as part of the current study) used to cluster new genomes in "species-level" OTUs, if any
Examples: NCBI Viral RefSeq;83
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000087
Namespacehttps://w3id.org/gensc/terms/
Groupsequencing
Data Type string
Requiredfalse
host_pred_appr
Tool or approach used for host prediction
Examples: CRISPR spacer match
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000088
Namespacehttps://w3id.org/gensc/terms/
Groupsequencing
Data Type Genomic Standards Consortium host_pred_appr Vocabulary (MIXS:0000088)
Requiredfalse
host_pred_est_acc
For each tool or approach used for host prediction, estimated false discovery rates should be included, either computed de novo or from the literature
Examples: CRISPR spacer match: 0 or 1 mismatches, estimated 8% FDR at the host genus rank (Edwards et al. 2016 doi:10.1093/femsre/fuv048)
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000089
Namespacehttps://w3id.org/gensc/terms/
Groupsequencing
Data Type string
Requiredfalse
url
Examples: http://www.earthmicrobiome.org/
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000091
Namespacehttps://w3id.org/gensc/terms/
Groupsequencing
Data Type uri
Requiredfalse
sop
Standard operating procedures used in assembly and/or annotation of genomes, metagenomes or environmental sequences
Examples: http://press.igsb.anl.gov/earthmicrobiome/protocols-and-standards/its/
Qualified Namehttps://w3id.org/gensc/terms/MIXS:0000090
Namespacehttps://w3id.org/gensc/terms/
Groupsequencing
Data Type uri
Requiredfalse
pcr_primer_forward
Forward PCR primer that were used to amplify the sequence of the targeted gene, locus or subfragment. If multiple multiple forward or reverse primers are present in a single PCR reaction, there should be a full row for each of these linked to the same DWC Occurrence. The primer sequence should be reported in uppercase letters
Examples: GGACTACHVGGGTWTCTAAT
Qualified Namehttp://rs.gbif.org/terms/pcr_primer_forward
Namespacehttp://rs.gbif.org/terms/
Groupsequencing
Data Type string
Requiredfalse
pcr_primer_reverse
Reverse PCR primer that were used to amplify the sequence of the targeted gene, locus or subfragment. If multiple multiple forward or reverse primers are present in a single PCR reaction, there should be a full row for each of these linked to the same DWC Occurrence. The primer sequence should be reported in uppercase letters
Examples: GGACTACHVGGGTWTCTAAT
Qualified Namehttp://rs.gbif.org/terms/pcr_primer_reverse
Namespacehttp://rs.gbif.org/terms/
Groupsequencing
Data Type string
Requiredfalse
pcr_primer_name_forward
Name of the forward PCR primer that were used to amplify the sequence of the targeted gene, locus or subfragment. If multiple multiple forward or reverse primers are present in a single PCR reaction, there should be a full row for each of these linked to the same DWC Occurrence.
Examples: jgLCO1490
Qualified Namehttp://rs.gbif.org/terms/pcr_primer_name_forward
Namespacehttp://rs.gbif.org/terms/
Groupsequencing
Data Type string
Requiredfalse
pcr_primer_name_reverse
Name of the reverse PCR primer that were used to amplify the sequence of the targeted gene, locus or subfragment. If multiple multiple forward or reverse primers are present in a single PCR reaction, there should be a full row for each of these linked to the same DWC Occurrence.
Examples: jgHCO2198
Qualified Namehttp://rs.gbif.org/terms/pcr_primer_name_reverse
Namespacehttp://rs.gbif.org/terms/
Groupsequencing
Data Type string
Requiredfalse
pcr_primer_reference
Reference for the PCR primers that were used to amplify the sequence of the targeted gene, locus or subfragment.
Examples: https://doi.org/10.1186/1742-9994-10-34
Qualified Namehttp://rs.gbif.org/terms/pcr_primer_reference
Namespacehttp://rs.gbif.org/terms/
Groupsequencing
Data Type string
Requiredfalse
DNA_sequence
The DNA sequence
Examples: TCTATCCTCAATTATAGGTCATAATTCACCATCAGTAGATTTAGGAATTTTCTCTATTCATATTGCAGGTGTATCATCAATTATAGGATCAATTAATTTTATTGTAACAATTTTAAATATACATACAAAAACTCATTCATTAAACTTTTTACCATTATTTTCATGATCAGTTCTAGTTACAGCAATTCTCCTTTTATTATCATTA
Qualified Namehttp://rs.gbif.org/terms/dna_sequence
Namespacehttp://rs.gbif.org/terms/
Groupsequencing
Data Type string
Requiredfalse

MaterialSample

concentration
Concentration of DNA (weight ng/volume µl)
See also http://terms.tdwg.org/wiki/ggbn:concentration
Examples: 67.5
Qualified Namehttp://data.ggbn.org/schemas/ggbn/terms/concentration
Namespacehttp://data.ggbn.org/schemas/ggbn/terms/
GroupMaterialSample
Data Type decimal
Requiredfalse
concentrationUnit
Unit used for concentration measurement
See also http://terms.tdwg.org/wiki/ggbn:concentrationUnit
Examples: ng/µl
Qualified Namehttp://data.ggbn.org/schemas/ggbn/terms/concentrationUnit
Namespacehttp://data.ggbn.org/schemas/ggbn/terms/
GroupMaterialSample
Data Type string
Requiredfalse
methodDeterminationConcentrationAndRatios
Description of method used for concentration measurement
See also http://terms.tdwg.org/wiki/ggbn:methodDeterminationConcentrationAndRatios
Examples: Nanodrop, Qubit
Qualified Namehttp://data.ggbn.org/schemas/ggbn/terms/methodDeterminationConcentrationAndRatios
Namespacehttp://data.ggbn.org/schemas/ggbn/terms/
GroupMaterialSample
Data Type string
Requiredfalse
ratioOfAbsorbance260_230
Ratio of absorbance at 260 nm and 230 nm assessing DNA purity (mostly secondary measure, indicates mainly EDTA, carbohydrates, phenol), (DNA samples only).
See also http://terms.tdwg.org/wiki/ggbn:ratioOfAbsorbance260_230
Examples: 1.89
Qualified Namehttp://data.ggbn.org/schemas/ggbn/terms/ratioOfAbsorbance260_230
Namespacehttp://data.ggbn.org/schemas/ggbn/terms/
GroupMaterialSample
Data Type decimal
Requiredfalse
ratioOfAbsorbance260_280
Ratio of absorbance at 280 nm and 230 nm assessing DNA purity (mostly secondary measure, indicates mainly EDTA, carbohydrates, phenol), (DNA samples only).
See also http://terms.tdwg.org/wiki/ggbn:ratioOfAbsorbance260_280
Examples: 1.91
Qualified Namehttp://data.ggbn.org/schemas/ggbn/terms/ratioOfAbsorbance260_280
Namespacehttp://data.ggbn.org/schemas/ggbn/terms/
GroupMaterialSample
Data Type decimal
Requiredfalse

nucleic acid sequence source

annealingTemp
The reaction temperature during the annealing phase of PCR.
Examples: 60
Qualified Namehttp://rs.gbif.org/terms/miqe/annealingTemp
Namespacehttp://rs.gbif.org/terms/miqe/
Groupnucleic acid sequence source
Data Type decimal
Requiredfalse
annealingTempUnit
Measurement unit of the reaction temperature during the annealing phase of PCR.
Examples: Degrees celsius
Qualified Namehttp://rs.gbif.org/terms/miqe/annealingTempUnit
Namespacehttp://rs.gbif.org/terms/miqe/
Groupnucleic acid sequence source
Data Type string
Requiredfalse
probeReporter
Type of fluorophore (reporter) used. Probe anneals within amplified target DNA. Polymerase activity degrades the probe that has annealed to the template, and the probe releases the fluorophore from it and breaks the proximity to the quencher, thus allowing fluorescence of the fluorophore.
Examples: FAM
Qualified Namehttp://rs.gbif.org/terms/miqe/probeReporter
Namespacehttp://rs.gbif.org/terms/miqe/
Groupnucleic acid sequence source
Data Type string
Requiredfalse
probeQuencher
Type of quencher used. The quencher molecule quenches the fluorescence emitted by the fluorophore when excited by the cycler’s light source As long as fluorophore and the quencher are in proximity, quenching inhibits any fluorescence signals.
Examples: NFQ-MGB
Qualified Namehttp://rs.gbif.org/terms/miqe/probeQuencher
Namespacehttp://rs.gbif.org/terms/miqe/
Groupnucleic acid sequence source
Data Type string
Requiredfalse
ampliconSize
The length of the amplicon in basepairs.
Examples: 83
Qualified Namehttp://rs.gbif.org/terms/miqe/ampliconSize
Namespacehttp://rs.gbif.org/terms/miqe/
Groupnucleic acid sequence source
Data Type integer
Requiredfalse
thresholdQuantificationCycle
Threshold for change in fluorescence signal between cycles
Examples: 0.3
Qualified Namehttp://rs.gbif.org/terms/miqe/thresholdQuantificationCycle
Namespacehttp://rs.gbif.org/terms/miqe/
Groupnucleic acid sequence source
Data Type decimal
Requiredfalse
baselineValue
The number of cycles when fluorescence signal from the target amplification is below background fluorescence not originated from the real target amplification.
Examples: 15
Qualified Namehttp://rs.gbif.org/terms/miqe/baselineValue
Namespacehttp://rs.gbif.org/terms/miqe/
Groupnucleic acid sequence source
Data Type integer
Requiredfalse
quantificationCycle
The number of cycles required for the fluorescent signal to cross a given value threshold above the baseline. Quantification cycle (Cq), threshold cycle (Ct), crossing point (Cp), and take-off point (TOP) refer to the same value from the real-time instrument. Use of quantification cycle (Cq), is preferable according to the RDML (Real-Time PCR Data Markup Language) data standard (http://www.rdml.org).
Examples: 37.9450950622558
Qualified Namehttp://rs.gbif.org/terms/miqe/quantificationCycle
Namespacehttp://rs.gbif.org/terms/miqe/
Groupnucleic acid sequence source
Data Type decimal
Requiredfalse
automaticThresholdQuantificationCycle
Whether the threshold was set by the instrument or manually.
Examples: true
Qualified Namehttp://rs.gbif.org/terms/miqe/automaticThresholdQuantificationCycle
Namespacehttp://rs.gbif.org/terms/miqe/
Groupnucleic acid sequence source
Data Type boolean
Requiredfalse
automaticBaselineValue
Whether the baseline value was set by the instrument or manually.
Examples: true
Qualified Namehttp://rs.gbif.org/terms/miqe/automaticBaselineValue
Namespacehttp://rs.gbif.org/terms/miqe/
Groupnucleic acid sequence source
Data Type boolean
Requiredfalse
contaminationAssessment
Whether DNA or RNA contamination assessment was done or not.
Examples: true
Qualified Namehttp://rs.gbif.org/terms/miqe/contaminationAssessment
Namespacehttp://rs.gbif.org/terms/miqe/
Groupnucleic acid sequence source
Data Type boolean
Requiredfalse
partitionVolume
An accurate estimation of partition volume. The sum of the partitions multiplied by the partition volume will enable the total volume of the reaction to be calculated.
Examples: 1
Qualified Namehttp://rs.gbif.org/terms/miqe/partitionVolume
Namespacehttp://rs.gbif.org/terms/miqe/
Groupnucleic acid sequence source
Data Type decimal
Requiredfalse
partitionVolumeUnit
Unit used for partition volume
Examples: nl
Qualified Namehttp://rs.gbif.org/terms/miqe/partitionVolumeUnit
Namespacehttp://rs.gbif.org/terms/miqe/
Groupnucleic acid sequence source
Data Type string
Requiredfalse
estimatedNumberOfCopies
Number of target molecules per µl. Mean copies per partition (?) can be calculated using the number of partitions (n) and the estimated copy number in the total volume of all partitions (m) with a formula ?=m/n.
Examples: 10300
Qualified Namehttp://rs.gbif.org/terms/miqe/estimatedNumberOfCopies
Namespacehttp://rs.gbif.org/terms/miqe/
Groupnucleic acid sequence source
Data Type integer
Requiredfalse
amplificationReactionVolume
PCR reaction volume
Examples: 22
Qualified Namehttp://rs.gbif.org/terms/miqe/amplificationReactionVolume
Namespacehttp://rs.gbif.org/terms/miqe/
Groupnucleic acid sequence source
Data Type decimal
Requiredfalse
amplificationReactionVolumeUnit
Unit used for PCR reaction volume. Many of the instruments require preparation of a much larger initial sample volume than is actually analyzed.
Examples: µl
Qualified Namehttp://rs.gbif.org/terms/miqe/amplificationReactionVolumeUnit
Namespacehttp://rs.gbif.org/terms/miqe/
Groupnucleic acid sequence source
Data Type string
Requiredfalse
pcr_analysis_software
The program used to analyse the d(d)PCR runs.
Examples: BIO-RAD QuantaSoft
Qualified Namehttp://rs.gbif.org/terms/miqe/pcr_analysis_software
Namespacehttp://rs.gbif.org/terms/miqe/
Groupnucleic acid sequence source
Data Type string
Requiredfalse
experimentalVariance
Multiple biological replicates are encouraged to assess total experimental variation. When single dPCR experiments are performed, a minimal estimate of variance due to counting error alone must be calculated from the binomial (or suitable equivalent) distribution.
Examples:
Qualified Namehttp://rs.gbif.org/terms/miqe/experimentalVariance
Namespacehttp://rs.gbif.org/terms/miqe/
Groupnucleic acid sequence source
Data Type string
Requiredfalse
pcr_primer_lod
The assay’s ability to detect the target at low levels.
Examples: 51
Qualified Namehttp://rs.gbif.org/terms/miqe/pcr_primer_lod
Namespacehttp://rs.gbif.org/terms/miqe/
Groupnucleic acid sequence source
Data Type string
Requiredfalse
pcr_primer_loq
The assay’s ability to quantify copy number at low levels.
Examples: 184
Qualified Namehttp://rs.gbif.org/terms/miqe/pcr_primer_loq
Namespacehttp://rs.gbif.org/terms/miqe/
Groupnucleic acid sequence source
Data Type string
Requiredfalse